ID: 1112954270

View in Genome Browser
Species Human (GRCh38)
Location 13:105039922-105039944
Sequence ATTGACATGGGCCTTATCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112954270_1112954274 12 Left 1112954270 13:105039922-105039944 CCAATGATAAGGCCCATGTCAAT No data
Right 1112954274 13:105039957-105039979 GCCTCAAGACCCTACTCTGGTGG No data
1112954270_1112954276 13 Left 1112954270 13:105039922-105039944 CCAATGATAAGGCCCATGTCAAT No data
Right 1112954276 13:105039958-105039980 CCTCAAGACCCTACTCTGGTGGG No data
1112954270_1112954273 9 Left 1112954270 13:105039922-105039944 CCAATGATAAGGCCCATGTCAAT No data
Right 1112954273 13:105039954-105039976 ACAGCCTCAAGACCCTACTCTGG No data
1112954270_1112954277 14 Left 1112954270 13:105039922-105039944 CCAATGATAAGGCCCATGTCAAT No data
Right 1112954277 13:105039959-105039981 CTCAAGACCCTACTCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112954270 Original CRISPR ATTGACATGGGCCTTATCAT TGG (reversed) Intergenic
No off target data available for this crispr