ID: 1112959414

View in Genome Browser
Species Human (GRCh38)
Location 13:105105184-105105206
Sequence CTCTTTCTGATGCAAGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112959413_1112959414 8 Left 1112959413 13:105105153-105105175 CCTCTTACATCTTTGTATTGTAC No data
Right 1112959414 13:105105184-105105206 CTCTTTCTGATGCAAGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112959414 Original CRISPR CTCTTTCTGATGCAAGTACC AGG Intergenic
No off target data available for this crispr