ID: 1112963669

View in Genome Browser
Species Human (GRCh38)
Location 13:105160078-105160100
Sequence TCTGTCTTGCGAGGTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112963669_1112963675 27 Left 1112963669 13:105160078-105160100 CCCAGAGCACCTCGCAAGACAGA No data
Right 1112963675 13:105160128-105160150 TAAATTACCTCTCCTCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112963669 Original CRISPR TCTGTCTTGCGAGGTGCTCT GGG (reversed) Intergenic