ID: 1112963675

View in Genome Browser
Species Human (GRCh38)
Location 13:105160128-105160150
Sequence TAAATTACCTCTCCTCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112963669_1112963675 27 Left 1112963669 13:105160078-105160100 CCCAGAGCACCTCGCAAGACAGA No data
Right 1112963675 13:105160128-105160150 TAAATTACCTCTCCTCTCCAAGG No data
1112963672_1112963675 18 Left 1112963672 13:105160087-105160109 CCTCGCAAGACAGAGTGTGAGGA No data
Right 1112963675 13:105160128-105160150 TAAATTACCTCTCCTCTCCAAGG No data
1112963670_1112963675 26 Left 1112963670 13:105160079-105160101 CCAGAGCACCTCGCAAGACAGAG No data
Right 1112963675 13:105160128-105160150 TAAATTACCTCTCCTCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112963675 Original CRISPR TAAATTACCTCTCCTCTCCA AGG Intergenic