ID: 1112964046

View in Genome Browser
Species Human (GRCh38)
Location 13:105165093-105165115
Sequence CCTCTGCCACAAAGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112964040_1112964046 1 Left 1112964040 13:105165069-105165091 CCTCATCCATAAGTGTGAAATAA No data
Right 1112964046 13:105165093-105165115 CCTCTGCCACAAAGGGAACAGGG No data
1112964039_1112964046 9 Left 1112964039 13:105165061-105165083 CCTCAATTCCTCATCCATAAGTG No data
Right 1112964046 13:105165093-105165115 CCTCTGCCACAAAGGGAACAGGG No data
1112964041_1112964046 -5 Left 1112964041 13:105165075-105165097 CCATAAGTGTGAAATAAACCTCT No data
Right 1112964046 13:105165093-105165115 CCTCTGCCACAAAGGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112964046 Original CRISPR CCTCTGCCACAAAGGGAACA GGG Intergenic
No off target data available for this crispr