ID: 1112964408

View in Genome Browser
Species Human (GRCh38)
Location 13:105169450-105169472
Sequence CCTTTCCTAGGGATTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112964408_1112964413 12 Left 1112964408 13:105169450-105169472 CCAGAGGAAATCCCTAGGAAAGG No data
Right 1112964413 13:105169485-105169507 TTAGAATAGCAGTTACCTGTAGG No data
1112964408_1112964414 13 Left 1112964408 13:105169450-105169472 CCAGAGGAAATCCCTAGGAAAGG No data
Right 1112964414 13:105169486-105169508 TAGAATAGCAGTTACCTGTAGGG No data
1112964408_1112964415 25 Left 1112964408 13:105169450-105169472 CCAGAGGAAATCCCTAGGAAAGG No data
Right 1112964415 13:105169498-105169520 TACCTGTAGGGCCTGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112964408 Original CRISPR CCTTTCCTAGGGATTTCCTC TGG (reversed) Intergenic
No off target data available for this crispr