ID: 1112964412

View in Genome Browser
Species Human (GRCh38)
Location 13:105169462-105169484
Sequence ACACCTGTAGCTCCTTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112964412_1112964415 13 Left 1112964412 13:105169462-105169484 CCTAGGAAAGGAGCTACAGGTGT No data
Right 1112964415 13:105169498-105169520 TACCTGTAGGGCCTGAAATAAGG No data
1112964412_1112964414 1 Left 1112964412 13:105169462-105169484 CCTAGGAAAGGAGCTACAGGTGT No data
Right 1112964414 13:105169486-105169508 TAGAATAGCAGTTACCTGTAGGG No data
1112964412_1112964419 28 Left 1112964412 13:105169462-105169484 CCTAGGAAAGGAGCTACAGGTGT No data
Right 1112964419 13:105169513-105169535 AAATAAGGAGTGTTGAGAGAGGG No data
1112964412_1112964418 27 Left 1112964412 13:105169462-105169484 CCTAGGAAAGGAGCTACAGGTGT No data
Right 1112964418 13:105169512-105169534 GAAATAAGGAGTGTTGAGAGAGG No data
1112964412_1112964413 0 Left 1112964412 13:105169462-105169484 CCTAGGAAAGGAGCTACAGGTGT No data
Right 1112964413 13:105169485-105169507 TTAGAATAGCAGTTACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112964412 Original CRISPR ACACCTGTAGCTCCTTTCCT AGG (reversed) Intergenic
No off target data available for this crispr