ID: 1112964413

View in Genome Browser
Species Human (GRCh38)
Location 13:105169485-105169507
Sequence TTAGAATAGCAGTTACCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112964408_1112964413 12 Left 1112964408 13:105169450-105169472 CCAGAGGAAATCCCTAGGAAAGG No data
Right 1112964413 13:105169485-105169507 TTAGAATAGCAGTTACCTGTAGG No data
1112964411_1112964413 1 Left 1112964411 13:105169461-105169483 CCCTAGGAAAGGAGCTACAGGTG No data
Right 1112964413 13:105169485-105169507 TTAGAATAGCAGTTACCTGTAGG No data
1112964406_1112964413 19 Left 1112964406 13:105169443-105169465 CCTAGAGCCAGAGGAAATCCCTA No data
Right 1112964413 13:105169485-105169507 TTAGAATAGCAGTTACCTGTAGG No data
1112964404_1112964413 30 Left 1112964404 13:105169432-105169454 CCAGTATTGTTCCTAGAGCCAGA No data
Right 1112964413 13:105169485-105169507 TTAGAATAGCAGTTACCTGTAGG No data
1112964412_1112964413 0 Left 1112964412 13:105169462-105169484 CCTAGGAAAGGAGCTACAGGTGT No data
Right 1112964413 13:105169485-105169507 TTAGAATAGCAGTTACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112964413 Original CRISPR TTAGAATAGCAGTTACCTGT AGG Intergenic
No off target data available for this crispr