ID: 1112964414

View in Genome Browser
Species Human (GRCh38)
Location 13:105169486-105169508
Sequence TAGAATAGCAGTTACCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112964408_1112964414 13 Left 1112964408 13:105169450-105169472 CCAGAGGAAATCCCTAGGAAAGG No data
Right 1112964414 13:105169486-105169508 TAGAATAGCAGTTACCTGTAGGG No data
1112964411_1112964414 2 Left 1112964411 13:105169461-105169483 CCCTAGGAAAGGAGCTACAGGTG No data
Right 1112964414 13:105169486-105169508 TAGAATAGCAGTTACCTGTAGGG No data
1112964412_1112964414 1 Left 1112964412 13:105169462-105169484 CCTAGGAAAGGAGCTACAGGTGT No data
Right 1112964414 13:105169486-105169508 TAGAATAGCAGTTACCTGTAGGG No data
1112964406_1112964414 20 Left 1112964406 13:105169443-105169465 CCTAGAGCCAGAGGAAATCCCTA No data
Right 1112964414 13:105169486-105169508 TAGAATAGCAGTTACCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112964414 Original CRISPR TAGAATAGCAGTTACCTGTA GGG Intergenic
No off target data available for this crispr