ID: 1112966093

View in Genome Browser
Species Human (GRCh38)
Location 13:105196055-105196077
Sequence GGTCAGGCTAATACAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112966085_1112966093 14 Left 1112966085 13:105196018-105196040 CCACTTATACCCTCCTTCAATTA No data
Right 1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG No data
1112966092_1112966093 -9 Left 1112966092 13:105196041-105196063 CCTGCAAAATTAAGGGTCAGGCT No data
Right 1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG No data
1112966084_1112966093 29 Left 1112966084 13:105196003-105196025 CCACTGTACTTATTTCCACTTAT No data
Right 1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG No data
1112966086_1112966093 5 Left 1112966086 13:105196027-105196049 CCCTCCTTCAATTACCTGCAAAA No data
Right 1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG No data
1112966088_1112966093 1 Left 1112966088 13:105196031-105196053 CCTTCAATTACCTGCAAAATTAA No data
Right 1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG No data
1112966087_1112966093 4 Left 1112966087 13:105196028-105196050 CCTCCTTCAATTACCTGCAAAAT No data
Right 1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112966093 Original CRISPR GGTCAGGCTAATACAAATTG AGG Intergenic
No off target data available for this crispr