ID: 1112966102

View in Genome Browser
Species Human (GRCh38)
Location 13:105196119-105196141
Sequence CCCTCTCCATGGCAACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112966102_1112966108 29 Left 1112966102 13:105196119-105196141 CCAGCTGGTTGCCATGGAGAGGG No data
Right 1112966108 13:105196171-105196193 CTTGTAAATTGTCATGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112966102 Original CRISPR CCCTCTCCATGGCAACCAGC TGG (reversed) Intergenic