ID: 1112966105

View in Genome Browser
Species Human (GRCh38)
Location 13:105196130-105196152
Sequence GAGTTTGCTGCCCCTCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112966105_1112966110 22 Left 1112966105 13:105196130-105196152 CCATGGAGAGGGGCAGCAAACTC No data
Right 1112966110 13:105196175-105196197 TAAATTGTCATGACGCTGGTGGG No data
1112966105_1112966108 18 Left 1112966105 13:105196130-105196152 CCATGGAGAGGGGCAGCAAACTC No data
Right 1112966108 13:105196171-105196193 CTTGTAAATTGTCATGACGCTGG No data
1112966105_1112966109 21 Left 1112966105 13:105196130-105196152 CCATGGAGAGGGGCAGCAAACTC No data
Right 1112966109 13:105196174-105196196 GTAAATTGTCATGACGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112966105 Original CRISPR GAGTTTGCTGCCCCTCTCCA TGG (reversed) Intergenic
No off target data available for this crispr