ID: 1112966106

View in Genome Browser
Species Human (GRCh38)
Location 13:105196152-105196174
Sequence CAAGTGCTATGGCAATATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112966106_1112966108 -4 Left 1112966106 13:105196152-105196174 CCTAGATATTGCCATAGCACTTG No data
Right 1112966108 13:105196171-105196193 CTTGTAAATTGTCATGACGCTGG No data
1112966106_1112966110 0 Left 1112966106 13:105196152-105196174 CCTAGATATTGCCATAGCACTTG No data
Right 1112966110 13:105196175-105196197 TAAATTGTCATGACGCTGGTGGG No data
1112966106_1112966109 -1 Left 1112966106 13:105196152-105196174 CCTAGATATTGCCATAGCACTTG No data
Right 1112966109 13:105196174-105196196 GTAAATTGTCATGACGCTGGTGG No data
1112966106_1112966111 27 Left 1112966106 13:105196152-105196174 CCTAGATATTGCCATAGCACTTG No data
Right 1112966111 13:105196202-105196224 TCTTATGCTAATGAGCAATGAGG No data
1112966106_1112966112 28 Left 1112966106 13:105196152-105196174 CCTAGATATTGCCATAGCACTTG No data
Right 1112966112 13:105196203-105196225 CTTATGCTAATGAGCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112966106 Original CRISPR CAAGTGCTATGGCAATATCT AGG (reversed) Intergenic