ID: 1112966109 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:105196174-105196196 |
Sequence | GTAAATTGTCATGACGCTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1112966105_1112966109 | 21 | Left | 1112966105 | 13:105196130-105196152 | CCATGGAGAGGGGCAGCAAACTC | No data | ||
Right | 1112966109 | 13:105196174-105196196 | GTAAATTGTCATGACGCTGGTGG | No data | ||||
1112966106_1112966109 | -1 | Left | 1112966106 | 13:105196152-105196174 | CCTAGATATTGCCATAGCACTTG | No data | ||
Right | 1112966109 | 13:105196174-105196196 | GTAAATTGTCATGACGCTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1112966109 | Original CRISPR | GTAAATTGTCATGACGCTGG TGG | Intergenic | ||