ID: 1112966110

View in Genome Browser
Species Human (GRCh38)
Location 13:105196175-105196197
Sequence TAAATTGTCATGACGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112966105_1112966110 22 Left 1112966105 13:105196130-105196152 CCATGGAGAGGGGCAGCAAACTC No data
Right 1112966110 13:105196175-105196197 TAAATTGTCATGACGCTGGTGGG No data
1112966106_1112966110 0 Left 1112966106 13:105196152-105196174 CCTAGATATTGCCATAGCACTTG No data
Right 1112966110 13:105196175-105196197 TAAATTGTCATGACGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112966110 Original CRISPR TAAATTGTCATGACGCTGGT GGG Intergenic