ID: 1112973462

View in Genome Browser
Species Human (GRCh38)
Location 13:105288180-105288202
Sequence TCTTCTCCAGGGTAGATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112973462_1112973467 23 Left 1112973462 13:105288180-105288202 CCTAACATCTACCCTGGAGAAGA No data
Right 1112973467 13:105288226-105288248 TCTAACAAAGCATCTAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112973462 Original CRISPR TCTTCTCCAGGGTAGATGTT AGG (reversed) Intergenic
No off target data available for this crispr