ID: 1112973467

View in Genome Browser
Species Human (GRCh38)
Location 13:105288226-105288248
Sequence TCTAACAAAGCATCTAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112973462_1112973467 23 Left 1112973462 13:105288180-105288202 CCTAACATCTACCCTGGAGAAGA No data
Right 1112973467 13:105288226-105288248 TCTAACAAAGCATCTAAGTCTGG No data
1112973464_1112973467 12 Left 1112973464 13:105288191-105288213 CCCTGGAGAAGAAAATATGAGGG No data
Right 1112973467 13:105288226-105288248 TCTAACAAAGCATCTAAGTCTGG No data
1112973460_1112973467 25 Left 1112973460 13:105288178-105288200 CCCCTAACATCTACCCTGGAGAA No data
Right 1112973467 13:105288226-105288248 TCTAACAAAGCATCTAAGTCTGG No data
1112973461_1112973467 24 Left 1112973461 13:105288179-105288201 CCCTAACATCTACCCTGGAGAAG No data
Right 1112973467 13:105288226-105288248 TCTAACAAAGCATCTAAGTCTGG No data
1112973466_1112973467 11 Left 1112973466 13:105288192-105288214 CCTGGAGAAGAAAATATGAGGGA No data
Right 1112973467 13:105288226-105288248 TCTAACAAAGCATCTAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112973467 Original CRISPR TCTAACAAAGCATCTAAGTC TGG Intergenic
No off target data available for this crispr