ID: 1112975806

View in Genome Browser
Species Human (GRCh38)
Location 13:105315488-105315510
Sequence GGGATACTCCCTTGGGAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112975799_1112975806 2 Left 1112975799 13:105315463-105315485 CCATGGTTGACCATTTTGTCTCC No data
Right 1112975806 13:105315488-105315510 GGGATACTCCCTTGGGAACCCGG No data
1112975802_1112975806 -8 Left 1112975802 13:105315473-105315495 CCATTTTGTCTCCTTGGGATACT No data
Right 1112975806 13:105315488-105315510 GGGATACTCCCTTGGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112975806 Original CRISPR GGGATACTCCCTTGGGAACC CGG Intergenic
No off target data available for this crispr