ID: 1112976326

View in Genome Browser
Species Human (GRCh38)
Location 13:105323038-105323060
Sequence CTTTACATGGTGAAGAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112976322_1112976326 11 Left 1112976322 13:105323004-105323026 CCTGATTCACAGACGGTTTCTTT No data
Right 1112976326 13:105323038-105323060 CTTTACATGGTGAAGAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112976326 Original CRISPR CTTTACATGGTGAAGAAGTA AGG Intergenic
No off target data available for this crispr