ID: 1112984556

View in Genome Browser
Species Human (GRCh38)
Location 13:105431818-105431840
Sequence ATAATTCAGAAACCATTTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112984555_1112984556 4 Left 1112984555 13:105431791-105431813 CCTGCTGAGTTCTCAGAGGTCTA No data
Right 1112984556 13:105431818-105431840 ATAATTCAGAAACCATTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112984556 Original CRISPR ATAATTCAGAAACCATTTAT CGG Intergenic
No off target data available for this crispr