ID: 1112991096

View in Genome Browser
Species Human (GRCh38)
Location 13:105514791-105514813
Sequence TGTGCATCCCTGGACTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112991096_1112991100 -5 Left 1112991096 13:105514791-105514813 CCCTGTAAGTCCAGGGATGCACA No data
Right 1112991100 13:105514809-105514831 GCACATCAAGTTGTCTGTCAGGG No data
1112991096_1112991101 -1 Left 1112991096 13:105514791-105514813 CCCTGTAAGTCCAGGGATGCACA No data
Right 1112991101 13:105514813-105514835 ATCAAGTTGTCTGTCAGGGAAGG No data
1112991096_1112991099 -6 Left 1112991096 13:105514791-105514813 CCCTGTAAGTCCAGGGATGCACA No data
Right 1112991099 13:105514808-105514830 TGCACATCAAGTTGTCTGTCAGG No data
1112991096_1112991102 0 Left 1112991096 13:105514791-105514813 CCCTGTAAGTCCAGGGATGCACA No data
Right 1112991102 13:105514814-105514836 TCAAGTTGTCTGTCAGGGAAGGG No data
1112991096_1112991103 1 Left 1112991096 13:105514791-105514813 CCCTGTAAGTCCAGGGATGCACA No data
Right 1112991103 13:105514815-105514837 CAAGTTGTCTGTCAGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112991096 Original CRISPR TGTGCATCCCTGGACTTACA GGG (reversed) Intergenic
No off target data available for this crispr