ID: 1112991099

View in Genome Browser
Species Human (GRCh38)
Location 13:105514808-105514830
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112991096_1112991099 -6 Left 1112991096 13:105514791-105514813 CCCTGTAAGTCCAGGGATGCACA No data
Right 1112991099 13:105514808-105514830 TGCACATCAAGTTGTCTGTCAGG No data
1112991097_1112991099 -7 Left 1112991097 13:105514792-105514814 CCTGTAAGTCCAGGGATGCACAT No data
Right 1112991099 13:105514808-105514830 TGCACATCAAGTTGTCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112991099 Original CRISPR TGCACATCAAGTTGTCTGTC AGG Intergenic
No off target data available for this crispr