ID: 1112992640

View in Genome Browser
Species Human (GRCh38)
Location 13:105532852-105532874
Sequence GAAGTCCTCAGCAATACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112992638_1112992640 22 Left 1112992638 13:105532807-105532829 CCAAATAAAGCTGTAAGAGTGAG No data
Right 1112992640 13:105532852-105532874 GAAGTCCTCAGCAATACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112992640 Original CRISPR GAAGTCCTCAGCAATACCCT GGG Intergenic
No off target data available for this crispr