ID: 1112993570

View in Genome Browser
Species Human (GRCh38)
Location 13:105544601-105544623
Sequence CCCCACTCACTGATGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112993570_1112993575 -3 Left 1112993570 13:105544601-105544623 CCCAGTGCCATCAGTGAGTGGGG No data
Right 1112993575 13:105544621-105544643 GGGCTCTATGTCAGCCAACCGGG No data
1112993570_1112993578 15 Left 1112993570 13:105544601-105544623 CCCAGTGCCATCAGTGAGTGGGG No data
Right 1112993578 13:105544639-105544661 CCGGGAACAAGAATAATGCCTGG No data
1112993570_1112993574 -4 Left 1112993570 13:105544601-105544623 CCCAGTGCCATCAGTGAGTGGGG No data
Right 1112993574 13:105544620-105544642 GGGGCTCTATGTCAGCCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112993570 Original CRISPR CCCCACTCACTGATGGCACT GGG (reversed) Intergenic
No off target data available for this crispr