ID: 1112994789

View in Genome Browser
Species Human (GRCh38)
Location 13:105560429-105560451
Sequence ATGTGATGATGTGAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112994789_1112994795 9 Left 1112994789 13:105560429-105560451 CCCACTTCCTCACATCATCACAT No data
Right 1112994795 13:105560461-105560483 GGGCTTTAATACATGAACTTTGG No data
1112994789_1112994796 10 Left 1112994789 13:105560429-105560451 CCCACTTCCTCACATCATCACAT No data
Right 1112994796 13:105560462-105560484 GGCTTTAATACATGAACTTTGGG No data
1112994789_1112994797 26 Left 1112994789 13:105560429-105560451 CCCACTTCCTCACATCATCACAT No data
Right 1112994797 13:105560478-105560500 CTTTGGGCCCATAAAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112994789 Original CRISPR ATGTGATGATGTGAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr