ID: 1113000846

View in Genome Browser
Species Human (GRCh38)
Location 13:105634349-105634371
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113000843_1113000846 2 Left 1113000843 13:105634324-105634346 CCAGTCAATATTCTGGAATTCCA No data
Right 1113000846 13:105634349-105634371 CAGTTAATGCAGATCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113000846 Original CRISPR CAGTTAATGCAGATCAAACA GGG Intergenic
No off target data available for this crispr