ID: 1113003553 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:105672469-105672491 |
| Sequence | CTTGGGGTGTTCACTACTTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113003553_1113003559 | 22 | Left | 1113003553 | 13:105672469-105672491 | CCAGAAGTAGTGAACACCCCAAG | No data | ||
| Right | 1113003559 | 13:105672514-105672536 | GAAAGTCATGAATTCCTTTTTGG | No data | ||||
| 1113003553_1113003558 | -5 | Left | 1113003553 | 13:105672469-105672491 | CCAGAAGTAGTGAACACCCCAAG | No data | ||
| Right | 1113003558 | 13:105672487-105672509 | CCAAGAGAAGGAAAGAGATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113003553 | Original CRISPR | CTTGGGGTGTTCACTACTTC TGG (reversed) | Intergenic | ||