ID: 1113003553

View in Genome Browser
Species Human (GRCh38)
Location 13:105672469-105672491
Sequence CTTGGGGTGTTCACTACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113003553_1113003559 22 Left 1113003553 13:105672469-105672491 CCAGAAGTAGTGAACACCCCAAG No data
Right 1113003559 13:105672514-105672536 GAAAGTCATGAATTCCTTTTTGG No data
1113003553_1113003558 -5 Left 1113003553 13:105672469-105672491 CCAGAAGTAGTGAACACCCCAAG No data
Right 1113003558 13:105672487-105672509 CCAAGAGAAGGAAAGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113003553 Original CRISPR CTTGGGGTGTTCACTACTTC TGG (reversed) Intergenic