ID: 1113004874

View in Genome Browser
Species Human (GRCh38)
Location 13:105688977-105688999
Sequence CCAGCATTTCAGTGTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113004874_1113004880 14 Left 1113004874 13:105688977-105688999 CCTCCTTCACACTGAAATGCTGG No data
Right 1113004880 13:105689014-105689036 TTCCACTGTAAGTCCAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113004874 Original CRISPR CCAGCATTTCAGTGTGAAGG AGG (reversed) Intergenic
No off target data available for this crispr