ID: 1113005589

View in Genome Browser
Species Human (GRCh38)
Location 13:105698446-105698468
Sequence CAGTGTGCTCTGTGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113005589_1113005594 -7 Left 1113005589 13:105698446-105698468 CCATATTCCCACAGAGCACACTG No data
Right 1113005594 13:105698462-105698484 CACACTGCATTCTTATATTGGGG No data
1113005589_1113005592 -9 Left 1113005589 13:105698446-105698468 CCATATTCCCACAGAGCACACTG No data
Right 1113005592 13:105698460-105698482 AGCACACTGCATTCTTATATTGG No data
1113005589_1113005593 -8 Left 1113005589 13:105698446-105698468 CCATATTCCCACAGAGCACACTG No data
Right 1113005593 13:105698461-105698483 GCACACTGCATTCTTATATTGGG No data
1113005589_1113005595 20 Left 1113005589 13:105698446-105698468 CCATATTCCCACAGAGCACACTG No data
Right 1113005595 13:105698489-105698511 TAGCTCCTTGTATTATAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113005589 Original CRISPR CAGTGTGCTCTGTGGGAATA TGG (reversed) Intergenic
No off target data available for this crispr