ID: 1113010190 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:105755870-105755892 |
| Sequence | CTTGATATACTGGTCAAACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113010188_1113010190 | -1 | Left | 1113010188 | 13:105755848-105755870 | CCAAGAAATCTAAATATATAGGC | No data | ||
| Right | 1113010190 | 13:105755870-105755892 | CTTGATATACTGGTCAAACAAGG | No data | ||||
| 1113010186_1113010190 | 0 | Left | 1113010186 | 13:105755847-105755869 | CCCAAGAAATCTAAATATATAGG | No data | ||
| Right | 1113010190 | 13:105755870-105755892 | CTTGATATACTGGTCAAACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113010190 | Original CRISPR | CTTGATATACTGGTCAAACA AGG | Intergenic | ||
| No off target data available for this crispr | |||||