ID: 1113010190

View in Genome Browser
Species Human (GRCh38)
Location 13:105755870-105755892
Sequence CTTGATATACTGGTCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113010188_1113010190 -1 Left 1113010188 13:105755848-105755870 CCAAGAAATCTAAATATATAGGC No data
Right 1113010190 13:105755870-105755892 CTTGATATACTGGTCAAACAAGG No data
1113010186_1113010190 0 Left 1113010186 13:105755847-105755869 CCCAAGAAATCTAAATATATAGG No data
Right 1113010190 13:105755870-105755892 CTTGATATACTGGTCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113010190 Original CRISPR CTTGATATACTGGTCAAACA AGG Intergenic
No off target data available for this crispr