ID: 1113012467

View in Genome Browser
Species Human (GRCh38)
Location 13:105785581-105785603
Sequence ATCTTTCTCTAGCAGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113012467_1113012468 14 Left 1113012467 13:105785581-105785603 CCTTGTTACTGCTAGAGAAAGAT No data
Right 1113012468 13:105785618-105785640 ATTGCCCTTTGAACAGTGCAAGG No data
1113012467_1113012472 22 Left 1113012467 13:105785581-105785603 CCTTGTTACTGCTAGAGAAAGAT No data
Right 1113012472 13:105785626-105785648 TTGAACAGTGCAAGGGTTAGAGG No data
1113012467_1113012469 15 Left 1113012467 13:105785581-105785603 CCTTGTTACTGCTAGAGAAAGAT No data
Right 1113012469 13:105785619-105785641 TTGCCCTTTGAACAGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113012467 Original CRISPR ATCTTTCTCTAGCAGTAACA AGG (reversed) Intergenic
No off target data available for this crispr