ID: 1113013102

View in Genome Browser
Species Human (GRCh38)
Location 13:105793419-105793441
Sequence CTCAGGAAACATATTCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113013095_1113013102 5 Left 1113013095 13:105793391-105793413 CCATGGCAGCATCAACTTCTAGG No data
Right 1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG No data
1113013093_1113013102 23 Left 1113013093 13:105793373-105793395 CCGCAGGCTGTACAGGAACCATG No data
Right 1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113013102 Original CRISPR CTCAGGAAACATATTCATGG CGG Intergenic
No off target data available for this crispr