ID: 1113014573

View in Genome Browser
Species Human (GRCh38)
Location 13:105814041-105814063
Sequence TAATGAGATCAGCCCCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113014573_1113014576 14 Left 1113014573 13:105814041-105814063 CCATTAAGGGGCTGATCTCATTA No data
Right 1113014576 13:105814078-105814100 TGTCATTAATTGTGTGACCTGGG No data
1113014573_1113014577 15 Left 1113014573 13:105814041-105814063 CCATTAAGGGGCTGATCTCATTA No data
Right 1113014577 13:105814079-105814101 GTCATTAATTGTGTGACCTGGGG No data
1113014573_1113014575 13 Left 1113014573 13:105814041-105814063 CCATTAAGGGGCTGATCTCATTA No data
Right 1113014575 13:105814077-105814099 CTGTCATTAATTGTGTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113014573 Original CRISPR TAATGAGATCAGCCCCTTAA TGG (reversed) Intergenic
No off target data available for this crispr