ID: 1113020081

View in Genome Browser
Species Human (GRCh38)
Location 13:105875298-105875320
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113020081_1113020084 -1 Left 1113020081 13:105875298-105875320 CCAGGTACCTTCTGGACAGAAGT No data
Right 1113020084 13:105875320-105875342 TACAATGTCAAGGACACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113020081 Original CRISPR ACTTCTGTCCAGAAGGTACC TGG (reversed) Intergenic
No off target data available for this crispr