ID: 1113022739

View in Genome Browser
Species Human (GRCh38)
Location 13:105906338-105906360
Sequence ACGAGGGCAGATGGGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113022739_1113022747 3 Left 1113022739 13:105906338-105906360 CCTTGCTCCCCATCTGCCCTCGT No data
Right 1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG No data
1113022739_1113022745 -4 Left 1113022739 13:105906338-105906360 CCTTGCTCCCCATCTGCCCTCGT No data
Right 1113022745 13:105906357-105906379 TCGTGAACACCTGAAGCAACTGG No data
1113022739_1113022746 2 Left 1113022739 13:105906338-105906360 CCTTGCTCCCCATCTGCCCTCGT No data
Right 1113022746 13:105906363-105906385 ACACCTGAAGCAACTGGAGCTGG No data
1113022739_1113022749 15 Left 1113022739 13:105906338-105906360 CCTTGCTCCCCATCTGCCCTCGT No data
Right 1113022749 13:105906376-105906398 CTGGAGCTGGGTCTGTAACATGG No data
1113022739_1113022750 24 Left 1113022739 13:105906338-105906360 CCTTGCTCCCCATCTGCCCTCGT No data
Right 1113022750 13:105906385-105906407 GGTCTGTAACATGGAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113022739 Original CRISPR ACGAGGGCAGATGGGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr