ID: 1113022742

View in Genome Browser
Species Human (GRCh38)
Location 13:105906347-105906369
Sequence CAGGTGTTCACGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113022742_1113022750 15 Left 1113022742 13:105906347-105906369 CCATCTGCCCTCGTGAACACCTG No data
Right 1113022750 13:105906385-105906407 GGTCTGTAACATGGAACTCCTGG No data
1113022742_1113022747 -6 Left 1113022742 13:105906347-105906369 CCATCTGCCCTCGTGAACACCTG No data
Right 1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG No data
1113022742_1113022752 28 Left 1113022742 13:105906347-105906369 CCATCTGCCCTCGTGAACACCTG No data
Right 1113022752 13:105906398-105906420 GAACTCCTGGTCAGAGACTTGGG No data
1113022742_1113022749 6 Left 1113022742 13:105906347-105906369 CCATCTGCCCTCGTGAACACCTG No data
Right 1113022749 13:105906376-105906398 CTGGAGCTGGGTCTGTAACATGG No data
1113022742_1113022746 -7 Left 1113022742 13:105906347-105906369 CCATCTGCCCTCGTGAACACCTG No data
Right 1113022746 13:105906363-105906385 ACACCTGAAGCAACTGGAGCTGG No data
1113022742_1113022751 27 Left 1113022742 13:105906347-105906369 CCATCTGCCCTCGTGAACACCTG No data
Right 1113022751 13:105906397-105906419 GGAACTCCTGGTCAGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113022742 Original CRISPR CAGGTGTTCACGAGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr