ID: 1113022743

View in Genome Browser
Species Human (GRCh38)
Location 13:105906354-105906376
Sequence GTTGCTTCAGGTGTTCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113022743_1113022752 21 Left 1113022743 13:105906354-105906376 CCCTCGTGAACACCTGAAGCAAC No data
Right 1113022752 13:105906398-105906420 GAACTCCTGGTCAGAGACTTGGG No data
1113022743_1113022750 8 Left 1113022743 13:105906354-105906376 CCCTCGTGAACACCTGAAGCAAC No data
Right 1113022750 13:105906385-105906407 GGTCTGTAACATGGAACTCCTGG No data
1113022743_1113022751 20 Left 1113022743 13:105906354-105906376 CCCTCGTGAACACCTGAAGCAAC No data
Right 1113022751 13:105906397-105906419 GGAACTCCTGGTCAGAGACTTGG No data
1113022743_1113022749 -1 Left 1113022743 13:105906354-105906376 CCCTCGTGAACACCTGAAGCAAC No data
Right 1113022749 13:105906376-105906398 CTGGAGCTGGGTCTGTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113022743 Original CRISPR GTTGCTTCAGGTGTTCACGA GGG (reversed) Intergenic
No off target data available for this crispr