ID: 1113022745

View in Genome Browser
Species Human (GRCh38)
Location 13:105906357-105906379
Sequence TCGTGAACACCTGAAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113022738_1113022745 -3 Left 1113022738 13:105906337-105906359 CCCTTGCTCCCCATCTGCCCTCG No data
Right 1113022745 13:105906357-105906379 TCGTGAACACCTGAAGCAACTGG No data
1113022739_1113022745 -4 Left 1113022739 13:105906338-105906360 CCTTGCTCCCCATCTGCCCTCGT No data
Right 1113022745 13:105906357-105906379 TCGTGAACACCTGAAGCAACTGG No data
1113022736_1113022745 27 Left 1113022736 13:105906307-105906329 CCTACAACTGAGCAGGTTCATGG No data
Right 1113022745 13:105906357-105906379 TCGTGAACACCTGAAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113022745 Original CRISPR TCGTGAACACCTGAAGCAAC TGG Intergenic
No off target data available for this crispr