ID: 1113022747

View in Genome Browser
Species Human (GRCh38)
Location 13:105906364-105906386
Sequence CACCTGAAGCAACTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113022742_1113022747 -6 Left 1113022742 13:105906347-105906369 CCATCTGCCCTCGTGAACACCTG No data
Right 1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG No data
1113022739_1113022747 3 Left 1113022739 13:105906338-105906360 CCTTGCTCCCCATCTGCCCTCGT No data
Right 1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG No data
1113022738_1113022747 4 Left 1113022738 13:105906337-105906359 CCCTTGCTCCCCATCTGCCCTCG No data
Right 1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG No data
1113022741_1113022747 -5 Left 1113022741 13:105906346-105906368 CCCATCTGCCCTCGTGAACACCT No data
Right 1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG No data
1113022740_1113022747 -4 Left 1113022740 13:105906345-105906367 CCCCATCTGCCCTCGTGAACACC No data
Right 1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113022747 Original CRISPR CACCTGAAGCAACTGGAGCT GGG Intergenic
No off target data available for this crispr