ID: 1113024709

View in Genome Browser
Species Human (GRCh38)
Location 13:105928191-105928213
Sequence GTCCTTCCACAGCAGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113024702_1113024709 26 Left 1113024702 13:105928142-105928164 CCTTGATACTACAACTCTCCTCA No data
Right 1113024709 13:105928191-105928213 GTCCTTCCACAGCAGAGTGTGGG No data
1113024705_1113024709 8 Left 1113024705 13:105928160-105928182 CCTCAAAGACTTGGATGTGGTCT No data
Right 1113024709 13:105928191-105928213 GTCCTTCCACAGCAGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113024709 Original CRISPR GTCCTTCCACAGCAGAGTGT GGG Intergenic
No off target data available for this crispr