ID: 1113033331

View in Genome Browser
Species Human (GRCh38)
Location 13:106018662-106018684
Sequence TGGTAACAGTTCAGTAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113033329_1113033331 14 Left 1113033329 13:106018625-106018647 CCACAGCACACAATCTGATATTT No data
Right 1113033331 13:106018662-106018684 TGGTAACAGTTCAGTAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113033331 Original CRISPR TGGTAACAGTTCAGTAATGC TGG Intergenic
No off target data available for this crispr