ID: 1113035205

View in Genome Browser
Species Human (GRCh38)
Location 13:106040475-106040497
Sequence AGATCCCACGCTCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113035202_1113035205 2 Left 1113035202 13:106040450-106040472 CCTAAGCAACCAATCAAGGCAAA No data
Right 1113035205 13:106040475-106040497 AGATCCCACGCTCAGGAGACAGG No data
1113035203_1113035205 -7 Left 1113035203 13:106040459-106040481 CCAATCAAGGCAAACAAGATCCC No data
Right 1113035205 13:106040475-106040497 AGATCCCACGCTCAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113035205 Original CRISPR AGATCCCACGCTCAGGAGAC AGG Intergenic
No off target data available for this crispr