ID: 1113037908

View in Genome Browser
Species Human (GRCh38)
Location 13:106071225-106071247
Sequence CCTTTAGAAGTGATTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113037908_1113037910 8 Left 1113037908 13:106071225-106071247 CCACAAGCAATCACTTCTAAAGG No data
Right 1113037910 13:106071256-106071278 TTCTAAGCAACTTTTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113037908 Original CRISPR CCTTTAGAAGTGATTGCTTG TGG (reversed) Intergenic