ID: 1113050202

View in Genome Browser
Species Human (GRCh38)
Location 13:106202779-106202801
Sequence TTGTCTGTCCAACTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113050202_1113050205 -7 Left 1113050202 13:106202779-106202801 CCCTGCTCCAGTTGGACAGACAA No data
Right 1113050205 13:106202795-106202817 CAGACAAATTTACATATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113050202 Original CRISPR TTGTCTGTCCAACTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr