ID: 1113054094

View in Genome Browser
Species Human (GRCh38)
Location 13:106249110-106249132
Sequence GGCTGGAGTCCGCTTTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113054094_1113054102 26 Left 1113054094 13:106249110-106249132 CCTGGCAAAAGCGGACTCCAGCC No data
Right 1113054102 13:106249159-106249181 ACACCAAGATTACTTCTACAGGG No data
1113054094_1113054101 25 Left 1113054094 13:106249110-106249132 CCTGGCAAAAGCGGACTCCAGCC No data
Right 1113054101 13:106249158-106249180 TACACCAAGATTACTTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113054094 Original CRISPR GGCTGGAGTCCGCTTTTGCC AGG (reversed) Intergenic
No off target data available for this crispr