ID: 1113055534

View in Genome Browser
Species Human (GRCh38)
Location 13:106263118-106263140
Sequence CTCTTGAAGTGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113055534_1113055539 15 Left 1113055534 13:106263118-106263140 CCTTCCACCTTCCACTTCAAGAG No data
Right 1113055539 13:106263156-106263178 GCCAGAGCAGTGAGTCATAAAGG No data
1113055534_1113055541 18 Left 1113055534 13:106263118-106263140 CCTTCCACCTTCCACTTCAAGAG No data
Right 1113055541 13:106263159-106263181 AGAGCAGTGAGTCATAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113055534 Original CRISPR CTCTTGAAGTGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr