ID: 1113056928

View in Genome Browser
Species Human (GRCh38)
Location 13:106278262-106278284
Sequence AGGTGGTGATGGGTGCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113056928_1113056933 -6 Left 1113056928 13:106278262-106278284 CCACGTAGCACCCATCACCACCT No data
Right 1113056933 13:106278279-106278301 CCACCTCAAAAACACACATTGGG No data
1113056928_1113056931 -7 Left 1113056928 13:106278262-106278284 CCACGTAGCACCCATCACCACCT No data
Right 1113056931 13:106278278-106278300 ACCACCTCAAAAACACACATTGG No data
1113056928_1113056935 6 Left 1113056928 13:106278262-106278284 CCACGTAGCACCCATCACCACCT No data
Right 1113056935 13:106278291-106278313 CACACATTGGGCACTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113056928 Original CRISPR AGGTGGTGATGGGTGCTACG TGG (reversed) Intergenic
No off target data available for this crispr