ID: 1113056931

View in Genome Browser
Species Human (GRCh38)
Location 13:106278278-106278300
Sequence ACCACCTCAAAAACACACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113056926_1113056931 18 Left 1113056926 13:106278237-106278259 CCAGGTTTGCTGGTTTGTTCTCT No data
Right 1113056931 13:106278278-106278300 ACCACCTCAAAAACACACATTGG No data
1113056928_1113056931 -7 Left 1113056928 13:106278262-106278284 CCACGTAGCACCCATCACCACCT No data
Right 1113056931 13:106278278-106278300 ACCACCTCAAAAACACACATTGG No data
1113056927_1113056931 -6 Left 1113056927 13:106278261-106278283 CCCACGTAGCACCCATCACCACC No data
Right 1113056931 13:106278278-106278300 ACCACCTCAAAAACACACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113056931 Original CRISPR ACCACCTCAAAAACACACAT TGG Intergenic
No off target data available for this crispr