ID: 1113056933

View in Genome Browser
Species Human (GRCh38)
Location 13:106278279-106278301
Sequence CCACCTCAAAAACACACATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113056927_1113056933 -5 Left 1113056927 13:106278261-106278283 CCCACGTAGCACCCATCACCACC No data
Right 1113056933 13:106278279-106278301 CCACCTCAAAAACACACATTGGG No data
1113056926_1113056933 19 Left 1113056926 13:106278237-106278259 CCAGGTTTGCTGGTTTGTTCTCT No data
Right 1113056933 13:106278279-106278301 CCACCTCAAAAACACACATTGGG No data
1113056928_1113056933 -6 Left 1113056928 13:106278262-106278284 CCACGTAGCACCCATCACCACCT No data
Right 1113056933 13:106278279-106278301 CCACCTCAAAAACACACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113056933 Original CRISPR CCACCTCAAAAACACACATT GGG Intergenic
No off target data available for this crispr