ID: 1113056935

View in Genome Browser
Species Human (GRCh38)
Location 13:106278291-106278313
Sequence CACACATTGGGCACTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113056928_1113056935 6 Left 1113056928 13:106278262-106278284 CCACGTAGCACCCATCACCACCT No data
Right 1113056935 13:106278291-106278313 CACACATTGGGCACTTTTAAAGG No data
1113056927_1113056935 7 Left 1113056927 13:106278261-106278283 CCCACGTAGCACCCATCACCACC No data
Right 1113056935 13:106278291-106278313 CACACATTGGGCACTTTTAAAGG No data
1113056929_1113056935 -4 Left 1113056929 13:106278272-106278294 CCCATCACCACCTCAAAAACACA No data
Right 1113056935 13:106278291-106278313 CACACATTGGGCACTTTTAAAGG No data
1113056930_1113056935 -5 Left 1113056930 13:106278273-106278295 CCATCACCACCTCAAAAACACAC No data
Right 1113056935 13:106278291-106278313 CACACATTGGGCACTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113056935 Original CRISPR CACACATTGGGCACTTTTAA AGG Intergenic
No off target data available for this crispr